Example sentences of "be about [adv] [adj] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | ‘ MOST OF your articles seem to be about very physical hobbies , would you be interested in hearing about one that is n't ? ’ asked Rosemary Gardner who works in Harwell 's Market Intelligence Service , part of Business Strategy Unit . |
| 2 | Physical trapping is likely to be about as effective for neon , argon and krypton . |
| 3 | He realised with a shock that he was nervous — as nervous as a randy adolescent on a hot date — and likely to be about as subtle ! |
| 4 | Alina mostly took her breaks alone ; she 'd sit in a corner with a magazine , usually one of Adele 's old wildlife partworks , and be about as obtrusive as a church mouse until her time was over . |
| 5 | Without people like him we would n't have a PFK magazine and that would be about as bad as never having heard of fish at all ! |
| 6 | Pete did n't know whether to duck or run , and the choice was fairly academic anyway , as for the moment his body seemed to be about as responsive as a sack of rocks . |
| 7 | He has embarked on a drawing/painting course which seems to be about as full and hectic as yours , but then both your chosen activities are a mystery to me . |
| 8 | Unfortunately for Brooks , the potential market share for the Beast is likely to be about as high as that enjoyed by the Land Rover , which is really a function of its specialist design rather than any deficiency in the shoe . |
| 9 | The effect of the GC step in the context of GGGCCC motif seems to be about as large as that of AA/TT , i.e. it is apparently enough to cancel the macroscopic curvature of helically phased A-tracts.The origin of the macroscopic curvature for the ( AGGGCCCTAGAGGGGCCCTAG ) n DNA can be explained by an overall roll angle difference between the GGGCCC and CTAGAG sequence elements , which will add up if the two motifs are separated by a distance close to the helical repeat length . |
| 10 | She would n't be here now , dressed to the nines for an evening that would be about as thrilling as an attack of flu , if she had n't again responded in anger to her emotions . |
| 11 | For all that , the way in which he was publicly rebuked by Peter May , the chairman of Selectors , after returning home , and appointed only for the first Test against India , annoyed many people by its insensitivity and seemed to be about as productive as the shooting of Admiral Byng on his quarterdeck . |
| 12 | In 1894 T. H. Huxley wrote to the editor of Science-gossip ‘ To any one who respects the English language , I think scientist must be about as pleasing a word as electrocution . |
| 13 | After reading some of the comments from people who saw the game or who listened on the radio , the above seems to be about as true reporting as you 'd expect from the NOTW . |