Example sentences of "be [prep] [adv] [adj] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | " It 's humiliating to be worth more dead than alive . " |
| 2 | that 's what er that 's what you used to say er er er er you should never ever be worth more dead than alive . |
| 3 | ‘ MOST OF your articles seem to be about very physical hobbies , would you be interested in hearing about one that is n't ? ’ asked Rosemary Gardner who works in Harwell 's Market Intelligence Service , part of Business Strategy Unit . |
| 4 | These two assumptions are : that our main questions should be about how individual mental states relate to individual neural events ; and that we should view the mind primarily as something which represents reality . |
| 5 | Physical trapping is likely to be about as effective for neon , argon and krypton . |
| 6 | He realised with a shock that he was nervous — as nervous as a randy adolescent on a hot date — and likely to be about as subtle ! |
| 7 | Alina mostly took her breaks alone ; she 'd sit in a corner with a magazine , usually one of Adele 's old wildlife partworks , and be about as obtrusive as a church mouse until her time was over . |
| 8 | Without people like him we would n't have a PFK magazine and that would be about as bad as never having heard of fish at all ! |
| 9 | Pete did n't know whether to duck or run , and the choice was fairly academic anyway , as for the moment his body seemed to be about as responsive as a sack of rocks . |
| 10 | He has embarked on a drawing/painting course which seems to be about as full and hectic as yours , but then both your chosen activities are a mystery to me . |
| 11 | Unfortunately for Brooks , the potential market share for the Beast is likely to be about as high as that enjoyed by the Land Rover , which is really a function of its specialist design rather than any deficiency in the shoe . |
| 12 | The effect of the GC step in the context of GGGCCC motif seems to be about as large as that of AA/TT , i.e. it is apparently enough to cancel the macroscopic curvature of helically phased A-tracts.The origin of the macroscopic curvature for the ( AGGGCCCTAGAGGGGCCCTAG ) n DNA can be explained by an overall roll angle difference between the GGGCCC and CTAGAG sequence elements , which will add up if the two motifs are separated by a distance close to the helical repeat length . |
| 13 | She would n't be here now , dressed to the nines for an evening that would be about as thrilling as an attack of flu , if she had n't again responded in anger to her emotions . |
| 14 | For all that , the way in which he was publicly rebuked by Peter May , the chairman of Selectors , after returning home , and appointed only for the first Test against India , annoyed many people by its insensitivity and seemed to be about as productive as the shooting of Admiral Byng on his quarterdeck . |
| 15 | In 1894 T. H. Huxley wrote to the editor of Science-gossip ‘ To any one who respects the English language , I think scientist must be about as pleasing a word as electrocution . |
| 16 | After reading some of the comments from people who saw the game or who listened on the radio , the above seems to be about as true reporting as you 'd expect from the NOTW . |
| 17 | Even if your usual practice is to use handwritten notes there will be times when typed notes are preferable such as a difficult telephone conversation that you want on the record or a list of action points arising out of the meeting . |
| 18 | The governors acknowledge that there will be times when concerted central-bank intervention is desirable . |
| 19 | Nigel Clogstoun-Willmott has described it as an art ‘ needing the patience of an animal ’ , and undoubtedly there would be times when physical strength and endurance were the key to survival , for survive they must to make any contribution from their efforts . |
| 20 | It used to be for really petty things like not standing up , or shouting out the window , running up the dinner queue and pushing it . |
| 21 | What protection will there be for potentially unprofitable , yet necessary services to continue to be available under the NHS ? |
| 22 | But they must be for ever content to owe to the English that elegance and culture , which , if they had been vigilant and active , perhaps the English might have owed to them . ’ |
| 23 | For Freud , this would have been to replace one set of dogmatic assertions with another set , held by the believers to be for ever true , and providing a sense of false security for them . |
| 24 | In the event of a second conviction for a like offence , a member is liable , in addition to the penalties already named , to be adjudged to be for ever incapable of holding any public office , and to be incapable for five years of being registered as an elector or voting at an election either of members to serve in Parliament or of members of any public body . |
| 25 | The provision of homes for old people by local authorities is still for only about twenty places per thousand old people in an area , and many of these will be for very old and frail disabled people . |
| 26 | An important part of the discussion deals with the difficulty of deciding whether variation can be said to be between semantically equivalent forms which carry social meaning , or to encode an aspectual distinction ; this latter issue is treated in the context of a ( non-quantitative ) analysis of the semantic distinctions underlying tense and aspect marking ( see further 7.6 and 7.7 ) . |
| 27 | Because the parallel-stranded structure is fourfold symmetric , imino-imino contacts within the tetrad will be between magnetically equivalent protons , which will not lead to observable NOEs . |
| 28 | The main approach will be through fairly frequent and prolonged human contact . |
| 29 | I knew I must be of officially dead . |
| 30 | This information may be of rather general nature , because all DNA cytosine-C 5 methyltransferases are structurally related ( 28 , 34 , 35 ) ; conservation of the active-site ProCys motif also extends to thymidilate synthetase ( 36 ) . |