Example sentences of "was [adv] show to be " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | But the impression was soon shown to be erroneous . |
| 2 | The apparent symmetry of this arrangement was rapidly shown to be superficial and delusive . |
| 3 | An Italian , Bartolomeo Gosio , in 1896 , described the extraction of a crystalline substance from culture filtrates of a Penicillium : the substance was later shown to be a compound called mycophenolic acid , with interesting biological properties but no valuable antibacterial ones . |
| 4 | The presence of a peak was also shown to be significantly beneficial on several occasions , particularly in the adenoidectomy only group ( maximum effect 7.6 ( SE 2.4 ) dB ) . |
| 5 | Alternative translation initiation was also shown to be effective for the RNA of POU proteins pit-1 [ 26 ] and Oct-4 [ 17 ] where in each case two isoforms were detected . |
| 6 | Although it may seem that the developments were exclusively within geomorphology this was not the case , because environmental reconstruction was increasingly shown to be dependent upon knowledge of the ways in which the soils and sediments as well as the surface morphology related to past systems of vegetation and to patterns of climate . |
| 7 | The drug cyclosporin was then shown to be a particular effective immunosuppressive agent as a result of extensive experiments on mice , rats , dogs and pigs . |
| 8 | This axiom among others , has faithfully served science and technology for two millenniums , but was ultimately shown to be untrue , in cosmic terms , by Einstein . |
| 9 | When the Ea transgene expression was normalised to Eb expression instead of to β-actin alone , the Ea transgene expression was again shown to be position-independent and copy number-dependent for the Long constructs ( final column in Table 1 , including Long 11 ) . |
| 10 | The repetitive sequence ( AGGGCCCTAGAGGGGCCCTAG ) n was previously shown to be curved by gel mobility assays . |
| 11 | The assumption of failure on basic skills training was subsequently shown to be incorrect when the two surveys by HM Inspectorate were published , but then , as Reid ( 1978 ) argues , the DES seemed more interested in proposing solutions than in defining problems . |