Example sentences of "[det] [noun] [be] [conj] " in BNC.

  Next page
No Sentence
1 It has throughout been common ground that the benefit in this case to each taxpayer is that ‘ his son is allowed to participate in all the facilities afforded by the school to boys who are educated there . ’
2 The beauty of that trail is that you have the thrill of walking beneath the railway viaduct and carrying on up alongside the Allt Chonoghlais into Coire a' Ghabhalach , the mirror eastern corrie of the one gained by the Bridge of Orchy route .
3 It is unnecessary for the purpose of this case to determine whether that decision is or is not correct : I will assume ( without expressing any view on the point ) that it is .
4 She did n't know what that prayer was but she wondered if they meant it or if to most of them it was … just words and phrases .
5 The essence of that hope is that through self-knowledge , existing constraints on thought and action can be better appreciated and thereby overcome .
6 The remarkable thing about that response was that the hon. Member for Islington , South and Finsbury ( Mr. Smith ) failed to tell the House whether he agreed with our proposals .
7 The fact that a person is suffering from a mental disorder within the Mental Health Act 1983 does not preclude a legally effective consent ( ss. 57 and 58 ) The question in each case is whether the person was capable of understanding .
8 The whole significance of that Budget was that it was designed to eliminate the need for , or the risk of , the monetisation of debt as a result of the level of Government expenditure in relation to the level of the national product .
9 Now one of the interesting things about this is that they 've worked out , in order to erm achieve our sales forecast , erm the impact of recruitment for each branch is that we need a net growth in branch of one plus one for every er on every month .
10 The only meaning to that part was that he was on top of — i.e. , surpassing — her in public .
11 However , the important additional point in that case was that the transferor foundation was in principle and in fact a legal person whose objects were non-commercial .
12 The point of that story was that Scrooge could afford to be generous .
13 Oligonucleotide primers used in each PCR were as follows ; DP-1 84-249 , 5'-CGCGGATCCCCCAACACGCATTTTGTG-3' and 5'-CGCGGATCCCCTGCGGGCCTGCTG-3' ; DP-1 84-204 , 5'-CGCGGATCCCCCAACACGCATTTTGTG and CGCGGATCCGTTCTGGCACTCCTGAGC ; DP-1 146-249 ; 5'-CGCGGATCCTTCAGCGCTGCCGACAACCAC and 5'-CGCGGATCCCCTGCGGGCCTGCTG ; DP-1 84-166 , 5'-CGCGGATCCCCCAACACGCATTTTGTG and CGCGGATCCCCGGATGTTCTTCTGGTC .
14 But as the key diagram stands at the moment , because it goes north of Knaresborough in its indication of where the route proposal will be , I think if that i key diagram is to remain , it is right for the examination to consider what the need for that route is as opposed to a route or any other route which goes between Harrogate and Knaresborough .
15 Part of the reason there has been so little bloodshed is that nobody yet is certain who killed Mr Gandhi or why .
16 What he learned from that experience is that the aspirations and ambitions , for which Labour could not stand , has not yet found a voice ; to these aspirations the right kind of Tory message could be addressed .
17 Ken Pitt : ‘ But the big value of that album was that it brought David 's work to the attention of a lot of important people .
18 Not what that figure is or or what period it would be .
19 The basis for that submission was that the officers ought to have arrested offenders as soon as they had sufficient evidence .
20 That condition is that we cut ten minutes out of the running time . ’
21 Our experience of people in that condition is that they are not in a steady state so , rightly , the prescription must be altered almost day by day according to the pain of the patient .
22 What would the length of each side be if the perimeter was 20m ?
23 And perhaps the only surprising thing about that result is that , is that seven people have said no !
24 The significance of that result was that it was only Wales 's third win in five seasons in the competition .
25 In the process of negotiating conflict all the participants help to set the framework of ideas within which conflict is managed and a crucial dimension of this framework is that the Japanese people are characteristically said to defer to the national consensus .
26 Another finding was that having a combined receptionist and switchboard operator resulted in delays either to dealing with visitors or in answering incoming calls — and often both .
27 Another aspect of this change is that the return on investment has declined sharply .
28 The basic reason for this change is that the scale of government activity is so vast that , more and more , ministers have to delegate to their civil servants .
29 The reason given for this change is that there was recent wide coverage in the press of the case of an American paramedic who succeeded by fraudulent means in obtaining limited registration from the council .
30 One reason for this change is that the loosening of Russian control over Eastern Europe has bared old frictions .
  Next page