Example sentences of "[adv] it is [adv] [adv] [verb] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | Perhaps it is not generally known that David Farrington 's research on criminal careers suggests that the single most effective crime prevention policy is nursery education , which is denied to so many children in inner city areas . |
| 2 | Perhaps the target has been badly chosen or perhaps it is not clearly seen . |
| 3 | Perhaps it is n't fully appreciated how easy greenhouses are to move , especially if they are aluminium and just a few seasons old . |
| 4 | And so it is not easily worn away or eroded . |
| 5 | Nevertheless it is not financially troubled Japan , but Asia 's tigers who are leading the next wave of investment in the region . |
| 6 | Thus it is very well developed on fine-grained basic igneous and metamorphic rocks . |
| 7 | Thus it is often erroneously supposed that a provision of the Convention which merely prevents it from displacing or affecting a particular legal right thereby effectuates that right , whereas in truth the sole consequence of the provision is to leave the matter to be determined under the applicable national law . |
| 8 | Enjoy the warmth : outside it is almost certainly blowing razor blades from the Steppes . |
| 9 | But still it is very carefully structured with a setting verse , a narrative verse and finishing off with a reflective verse and 10 syllables in each line and Futility has the same feeling of careful planning and construction . |
| 10 | Now it is no longer used for worship , but acts as a useful starting point to the day 's walking . |
| 11 | Now it is once again receiving its due meed of praise . |
| 12 | In the post-Althusserian context of today it is nevertheless somewhat startling to find the Althusser of Reading Capital citing his debt to Foucault ( along with Bachelard , Cavaillès , and Canguilhem ) as one of our masters in reading learned works'. perhaps even more unexpected , in the light of the fact that a popular British Marxist position on Althusser is that he simply turned history into theory , is the choice of Foucault 's Madness and Civilization ( ’ that great work' ) and The Birth of the Clinic as examples of the kind of history , focused on the necessity of the production of a concept , that he was advocating . |
| 13 | Microscopically it is most readily distinguished from the latter by having long narrow spicules . |
| 14 | Certainly if the building at Thorpe is a mutatio , then it is not visibly imitated elsewhere ! |
| 15 | It dawns on me that if he had not succeeded in entering her then it is not legally rape . |
| 16 | The attempt is found occasionally in the work of their pupils , and at this time becomes quite frequent , but in vase-painting at least it is not successfully achieved until quite late in the century . |
| 17 | The system is seen working according to this plan in Fragment B , but even there it is not consistently maintained . |
| 18 | In the 1980s it has been acknowledged that the importance of formal ( tripartite ) arrangements at ‘ peak ’ levels has been reduced — indeed it is now often suggested that Britain was always less ‘ corporatist ’ in these terms than countries such as the Federal Republic of Germany , Austria and Sweden . |
| 19 | Here is music that is indefinably ridiculous , sentimental and full of stone age sexual politics , yet it is also deeply moving and irresistibly thrilling . |
| 20 | This analysis is necessary to an understanding of politics in Britain , and yet it is too often dismissed by Marxists , at least implicitly , as irrelevant . |
| 21 | To divide a book into chapters each dealing with a particular type is to sidestep the identification issue completely , yet it is still frequently done . |
| 22 | Accordingly it is no longer adding premium prices to the VAX Line — in the UK for instance , system prices for the VAX 4000 Model 500 have been reduced by between 14% and 21% across the range , with an unlimited open VMS user licence falling in price from £29,000 to £7000 — a 76% reduction . |
| 23 | Evidently it is not much use replacing existential propositions with their properly quantified " canonical " paraphrases , if the concept of existential quantification itself gives rise to obscurities and can not be made sufficiently precise . |
| 24 | The effect of the GC step in the context of GGGCCC motif seems to be about as large as that of AA/TT , i.e. it is apparently enough to cancel the macroscopic curvature of helically phased A-tracts.The origin of the macroscopic curvature for the ( AGGGCCCTAGAGGGGCCCTAG ) n DNA can be explained by an overall roll angle difference between the GGGCCC and CTAGAG sequence elements , which will add up if the two motifs are separated by a distance close to the helical repeat length . |
| 25 | It is not to be wondered at if , when a request is made of one person , another is obliged by a trust : for if the following is written in a will ‘ I ask you , Titius , having received a hundred to manumit that slave ’ or ‘ to give something to Sempronius ’ , certainly it is not adequately expressed , but a trust must all the same be understood to be charged on the heir to pay the money to Titius : and so Titius himself will sue the heir , and will be compelled to give freedom to the slave or to Sempronius what he was asked to . |