Example sentences of "[adv] it [is] [adv] [adv] [verb] " in BNC.
Next pageNo | Sentence |
---|---|
1 | Perhaps it 's too soon to mention next year ? |
2 | So it 's actually sometimes thinking about , can I tie in something else to this , which may bring the whole picture , bring it all together , but be creative . |
3 | Thus it is very well developed on fine-grained basic igneous and metamorphic rocks . |
4 | Thus it is often erroneously supposed that a provision of the Convention which merely prevents it from displacing or affecting a particular legal right thereby effectuates that right , whereas in truth the sole consequence of the provision is to leave the matter to be determined under the applicable national law . |
5 | Enjoy the warmth : outside it is almost certainly blowing razor blades from the Steppes . |
6 | But still it is very carefully structured with a setting verse , a narrative verse and finishing off with a reflective verse and 10 syllables in each line and Futility has the same feeling of careful planning and construction . |
7 | Er it moves up again in eighty five to eighty six and the general trend you can see is still upwards though it 's certainly not repeating the growth in this period . |
8 | Now it is no longer used for worship , but acts as a useful starting point to the day 's walking . |
9 | Now it is once again receiving its due meed of praise . |
10 | and things like that and it only , it 's only become and really it 's only actually set up as a business school quite recently as well , I mean what in the past ten years or something |
11 | Often it 's enough simply to suggest a division — perhaps by using a screen , or even a row of tall , leafy plants . |
12 | Erm it 's a difficult balance , change is very rarely popular and quite often it 's only ever talked about but sometimes it happens and even then it 's not popular but a balanced and open mind is required to approach change but perhaps more important , and this is n't always mentioned , suggestions about change tend to come from rather specific areas and there are rather specific interest groups which may start the process of change |
13 | In the post-Althusserian context of today it is nevertheless somewhat startling to find the Althusser of Reading Capital citing his debt to Foucault ( along with Bachelard , Cavaillès , and Canguilhem ) as one of our masters in reading learned works'. perhaps even more unexpected , in the light of the fact that a popular British Marxist position on Althusser is that he simply turned history into theory , is the choice of Foucault 's Madness and Civilization ( ’ that great work' ) and The Birth of the Clinic as examples of the kind of history , focused on the necessity of the production of a concept , that he was advocating . |
14 | Microscopically it is most readily distinguished from the latter by having long narrow spicules . |
15 | But the warning is that not every road is treated with salt — and even if it is , not every road is safe in icy conditions : and sometimes it 's even hard going for the experts . |
16 | It depends sometimes he gets the information sometimes it 's basically just registering your your approval with them . |
17 | Maybe I have done , maybe it 's just not printing it . |
18 | If the valuation has not been made in accordance with the express terms of the contract then it is clearly not binding . |
19 | I believe that if feminism has got something to say then it 's certainly not getting its message to the masses of ordinary women . |
20 | If it 's breaking down lots of food , a really heavy meal , then it 's actually maybe making such a big demand on the oxygen level in your bloodstream that your oxygen level in your bloodstream drops and there 's not enough to go round the muscles to make to break up any lactic acid that 's being formed . |
21 | Now , it 's obviously very good news that all this aid , that is there it 's just not getting to the people that need it , that it is now on the move but it is n't as simple as that is it ? |
22 | Switch it on there it 's just not working at all . |
23 | In the 1980s it has been acknowledged that the importance of formal ( tripartite ) arrangements at ‘ peak ’ levels has been reduced — indeed it is now often suggested that Britain was always less ‘ corporatist ’ in these terms than countries such as the Federal Republic of Germany , Austria and Sweden . |
24 | It 's all around us , it 's vitally important for the sustenance of life , yet it 's almost totally taken for granted . |
25 | Here is music that is indefinably ridiculous , sentimental and full of stone age sexual politics , yet it is also deeply moving and irresistibly thrilling . |
26 | This analysis is necessary to an understanding of politics in Britain , and yet it is too often dismissed by Marxists , at least implicitly , as irrelevant . |
27 | To divide a book into chapters each dealing with a particular type is to sidestep the identification issue completely , yet it is still frequently done . |
28 | Accordingly it is no longer adding premium prices to the VAX Line — in the UK for instance , system prices for the VAX 4000 Model 500 have been reduced by between 14% and 21% across the range , with an unlimited open VMS user licence falling in price from £29,000 to £7000 — a 76% reduction . |
29 | The effect of the GC step in the context of GGGCCC motif seems to be about as large as that of AA/TT , i.e. it is apparently enough to cancel the macroscopic curvature of helically phased A-tracts.The origin of the macroscopic curvature for the ( AGGGCCCTAGAGGGGCCCTAG ) n DNA can be explained by an overall roll angle difference between the GGGCCC and CTAGAG sequence elements , which will add up if the two motifs are separated by a distance close to the helical repeat length . |