Example sentences of "[adv] shown to be " in BNC.
Previous page Next page| No | Sentence |
|---|---|
| 31 | The drug cyclosporin was then shown to be a particular effective immunosuppressive agent as a result of extensive experiments on mice , rats , dogs and pigs . |
| 32 | A 240K protein previously shown to be tightly associated with the cGMP-gated channel of ROS membranes has been identified as a major calmodulin-binding protein of ROS membranes by affinity chromatography and western blotting . |
| 33 | The labelled probe used in these assays was a sequence derived from the herpes simplex virus immediate-early 1 gene which we have previously shown to be a high affinity binding site for octamer binding proteins ( 18 ) . |
| 34 | The repetitive sequence ( AGGGCCCTAGAGGGGCCCTAG ) n was previously shown to be curved by gel mobility assays . |
| 35 | When the Ea transgene expression was normalised to Eb expression instead of to β-actin alone , the Ea transgene expression was again shown to be position-independent and copy number-dependent for the Long constructs ( final column in Table 1 , including Long 11 ) . |
| 36 | This axiom among others , has faithfully served science and technology for two millenniums , but was ultimately shown to be untrue , in cosmic terms , by Einstein . |
| 37 | The discovery of deaf tutors in a sign language class causes a review of the concept of ‘ the deaf ’ as disabled , since for the first time the student may be in a learning situation where the person whom he feels he should be helping is actually shown to be more competent than he is . |
| 38 | This is actually shown to be level with the sixth step , so if the man sensibly puts the load down at the top of the stairs then 100 joules is the answer . |
| 39 | The assumption of failure on basic skills training was subsequently shown to be incorrect when the two surveys by HM Inspectorate were published , but then , as Reid ( 1978 ) argues , the DES seemed more interested in proposing solutions than in defining problems . |
| 40 | De Vries ' ‘ mutations ’ were subsequently shown to be the result of hybridization , not the production of new genetic characters . |
| 41 | There are many well documented cases in which a seemingly benign stricture on radiological grounds has been subsequently shown to be malignant . |
| 42 | If the purchaser does not take on such persons and they are subsequently shown to be employees , they will be protected by the Transfer Regulations and the purchaser will be liable for any costs of redundancy or dismissal . |