Example sentences of "its [adj] [conj] [art] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | A debate even begins about whether the army is not getting a little trigger-happy in its nervous and no doubt terrified tension . |
| 2 | For example it is well known that asthma and eczema are linked but what is frequently overlooked is the way that a person 's asthma can be bad at a time when their eczema is quiet and their eczema can be its worst when the asthma is quiet . |
| 3 | In 1272 the see of Canterbury was vacant and the pope provided the Dominican prior-provincial , Robert Kilwardby , an academic theologian , after setting aside both the chapter 's choice of its prior and the king 's favourite , Robert Burnell . |
| 4 | I thinking about it over erm er coffee sir , I I I think the answer is an adder erm because its smaller than an elephant , it 's indigenous to the United Kingdom , it blends into the landscape , but if you ignore it it could be just as injurious to your health . |
| 5 | Gloucester against Bridgend … that 's the game tonight … its more than a run out too … next week the cherry and whites are back in the first division fight at Northampton … but no chance of planning ahead six first teamers are missing |
| 6 | Recombinants ‘ oligo I ’ and ‘ oligo III ’ were produced by cloning the sequence CTGGGGAGGCGACCCCTCCCCCCTTGTCCCGACT ( nts -527 to -494 ) and its complementary or the oligonucleotide TCGCCCAGCTCAGGGCCGCGTGTGTTAGTT ( nts -479 to -450 ) and its complementary at the HindIII site of plasmid pBLcat2 ( 16 ) . |
| 7 | There must be a clear statement in its ultimate that no EEC body , Council , Commission or Court , shall be able to override legislation passed by national parliaments . |
| 8 | The bureaucracy , according to this line of analysis , exercises neither class power of its own nor the power of classes to which it is affiliated . |
| 9 | DSRM are in the Auckland District League , 100 years old this year and planning a bunfight of its own before the summer 's out . |
| 10 | A swivelling , vinyl-covered bucket seat is provided for the navigator : this takes a little getting used to at sea ( perhaps the fitting of a cramp lock would overcome this criticism ) , but it really comes into its own when the yacht is in harbour and the navigation station becomes part of the living area . |
| 11 | Finance of any resulting centre was on a one-for-one basis , the ILEA matching expenditure of school funds by a grant of its own if the advice and guidance of its support team was carried out i practice . |
| 12 | But immediately Hilton makes it clear that such a life-style involves an active life of its own if the peace that is sought is to be found , for it may not be had : This has been defined earlier as : Such an active component of spiritual endeavour is a concomitant of man 's temporal nature . |
| 13 | In the example of the paperclip business it is important to know whether the vendor has its own or an external design team . |
| 14 | Headache may be on its own or the forerunner of other complaints ; it accompanies almost all other illnesses . |
| 15 | The Dobermann really came into its own as a domestic dog in the 1980s and , subsequently , far too many were bred . |
| 16 | The government then developed a momentum of its own as a focus of loyalty that ran against the party system . |
| 17 | The business was established quickly and holding its own as the country plunged into recession . |
| 18 | It seemed to have a life of its own as the needle ate up the cloth . |
| 19 | The trolley also had a mind of its own and a tendency to advance crablike , sideways . |
| 20 | Umberto Eco 's magisterial novel The Name of the Rose ( 1983 ) , for example , plays on the dialectic between the reader 's curiosity about the medieval world and his/her almost total ignorance of it ( funnelled , as Eco explains in his Reflections on the novel , through the observations of the novice Adso ( Eco 1985 : 33–4 ) ; between the sense that the historical world ( the abbey and the cultural and religious context of the time ) is a world of its own and the sense that it is connected to the world of the reader . |
| 21 | Every sort of love has a value of its own and the wonderful thing is that there is a limitless supply if we care to call upon it . |
| 22 | The federation broke up in 1964 and David said : ‘ Zambia decided to continue a service of its own and the finger of fate pointed at me . |
| 23 | Each function embraces three vertical columns , the centre one on its own and the other two shared with the other functions . |
| 24 | Each function embraces three vertical columns , the centre one on its own and the other two shared with the other functions . |
| 25 | The number of students on CNAA courses was increasing rapidly , and exceeding its own and the institutions ' forecasts . |
| 26 | In an extreme case such as the Yorkshire estate village of Thrybergh the squire 's hall was in a class of its own and the parsonage was far superior to the rest . |
| 27 | Henley hosts conferences to report research outcomes from both its own and the wider academic community . |
| 28 | If that does not work , then the internal complaints procedure comes into its own and the dissatisfied client should be referred to another member of the firm ( possibly the senior partner ) or , though this perhaps will rarely be encountered , someone outside the firm who has been nominated to deal with such matters . |
| 29 | The KC-400 Brush Pen range offers attractions of its own and an ample colour range for the serious user . |
| 30 | This Report has argued that music can have a life of its own and an ability to communicate without the support of words . |