Example sentences of "[noun sg] can be explained by " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | This anomaly can be explained by a strong but short telemagmatic heating event , with coalification having preceded porosity loss of the reservoir rocks , and/or by fracture porosity gained through tectonic disturbance of the rocks . |
| 2 | The convoluted language to argue in favour of national control in the Tory manifesto can be explained by anxiety not to use the technical , but too foreign-sounding , EC term ‘ subsidiarity ’ . |
| 3 | The order of migration can be explained by the different diets of the different species . |
| 4 | Greater attention will be given to the nature of the long- run solution of the models , and the degree to which inter-model differences in the long run and in dynamic adjustment can be explained by empirical differences in economic approach . |
| 5 | A rising yield curve can be explained by liquidity preference theory . |
| 6 | Great care has been taken in the current depression , for example , to construct the image of scrounging , fiddling , laziness and greed as characteristic of the unemployed who ‘ could find work if they really wanted to ’ or whose misfortune can be explained by ‘ the irresponsible pay demands and restrictive practices ’ of those still in work . |
| 7 | The exaggerated acid response to gastrin can be explained by the increased parietal cell mass present in duodenal ulcer patients . |
| 8 | Statistical analysis indicates that a large proportion of the inter-university variation in the non-completion rate can be explained by three main factors : the scholastic ability of each university 's new entrants as reflected by A-level score ; the subject mix of each university ; and the proportion of each university 's students accommodated in a hall of residence . |
| 9 | Only group 5 did not propose the following pattern : ( i ) The relative rigidity of this pattern can be explained by reference to the cohesive chains which develop through it . |
| 10 | Like most things in Delhi , the curious position of the eunuchs in Indian society can be explained by the head-on collision of two very different traditions , one Muslim , one Hindu . |
| 11 | The effect of the GC step in the context of GGGCCC motif seems to be about as large as that of AA/TT , i.e. it is apparently enough to cancel the macroscopic curvature of helically phased A-tracts.The origin of the macroscopic curvature for the ( AGGGCCCTAGAGGGGCCCTAG ) n DNA can be explained by an overall roll angle difference between the GGGCCC and CTAGAG sequence elements , which will add up if the two motifs are separated by a distance close to the helical repeat length . |
| 12 | The extremely high intragastric ammonium concentration in the renal failure patients with H pylori infection can be explained by the combination of their high gastric juice urea concentration and the high urease activity of the organism . |
| 13 | But not all the remaining convergence can be explained by this process and it has been suggested that the rest has been accommodated by the lateral movement of blocks of continental lithosphere along east-west trending strike-slip faults to the north of the Tibetan Plateau in Mongolia and western China ( Fig. 3.24 ) . |
| 14 | The difference in atomic number can be explained by considering the breakdown of a neutron to form a proton and an electron . |
| 15 | This exception can be explained by a strong , but short heating event , by which the coalification process preceded the loss of porosity in the reservoir rocks . |
| 16 | This huge deficit can be explained by reference to the growth of demand within the USA which has drawn an increasing volume of imports . |
| 17 | The force with which the judges made their case for Second Empire can be explained by assuming that they felt that if they did not strongly press for this form of building , another , and less welcome style in their eyes , would be adopted . |
| 18 | In summary , this studh shows that in about 50% of patients with H pylori negative DU their disease can be explained by NSAID use , underlying Zollinger-Ellison syndrome , or Crohn 's disease . |
| 19 | In a few cases , the continued support for a political party can be explained by reference to an historical connection . |