Example sentences of "to be about as [adj] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | Physical trapping is likely to be about as effective for neon , argon and krypton . |
| 2 | He realised with a shock that he was nervous — as nervous as a randy adolescent on a hot date — and likely to be about as subtle ! |
| 3 | The effect of the GC step in the context of GGGCCC motif seems to be about as large as that of AA/TT , i.e. it is apparently enough to cancel the macroscopic curvature of helically phased A-tracts.The origin of the macroscopic curvature for the ( AGGGCCCTAGAGGGGCCCTAG ) n DNA can be explained by an overall roll angle difference between the GGGCCC and CTAGAG sequence elements , which will add up if the two motifs are separated by a distance close to the helical repeat length . |
| 4 | After reading some of the comments from people who saw the game or who listened on the radio , the above seems to be about as true reporting as you 'd expect from the NOTW . |
| 5 | For all that , the way in which he was publicly rebuked by Peter May , the chairman of Selectors , after returning home , and appointed only for the first Test against India , annoyed many people by its insensitivity and seemed to be about as productive as the shooting of Admiral Byng on his quarterdeck . |
| 6 | Unfortunately for Brooks , the potential market share for the Beast is likely to be about as high as that enjoyed by the Land Rover , which is really a function of its specialist design rather than any deficiency in the shoe . |
| 7 | Pete did n't know whether to duck or run , and the choice was fairly academic anyway , as for the moment his body seemed to be about as responsive as a sack of rocks . |
| 8 | He has embarked on a drawing/painting course which seems to be about as full and hectic as yours , but then both your chosen activities are a mystery to me . |