Example sentences of "to be [prep] [adv] [adj] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | The first type tend to be over more mundane matters , with the third being the more serious . |
| 2 | An important part of the discussion deals with the difficulty of deciding whether variation can be said to be between semantically equivalent forms which carry social meaning , or to encode an aspectual distinction ; this latter issue is treated in the context of a ( non-quantitative ) analysis of the semantic distinctions underlying tense and aspect marking ( see further 7.6 and 7.7 ) . |
| 3 | More than a thousand antiques have been recovered by detectives working out of Cirencester police station.They raided five different addresses in London earlier this week.And they found a hoard of paintings , porcelain and furniture estimated to be worth over two million pounds . |
| 4 | UAL chairman Stephen Wolf , who is under pressure from the rest of his board to deliver the company from its limbo state since the original $6.75billion buyout plan was dropped , began another round of talks this week with the airline 's employees and union leaders to raise support for a bid likely to be worth as little as $4.5billion . |
| 5 | " It 's humiliating to be worth more dead than alive . " |
| 6 | The estate turned out to be worth considerably less than I had hoped . |
| 7 | ‘ MOST OF your articles seem to be about very physical hobbies , would you be interested in hearing about one that is n't ? ’ asked Rosemary Gardner who works in Harwell 's Market Intelligence Service , part of Business Strategy Unit . |
| 8 | Physical trapping is likely to be about as effective for neon , argon and krypton . |
| 9 | He realised with a shock that he was nervous — as nervous as a randy adolescent on a hot date — and likely to be about as subtle ! |
| 10 | The effect of the GC step in the context of GGGCCC motif seems to be about as large as that of AA/TT , i.e. it is apparently enough to cancel the macroscopic curvature of helically phased A-tracts.The origin of the macroscopic curvature for the ( AGGGCCCTAGAGGGGCCCTAG ) n DNA can be explained by an overall roll angle difference between the GGGCCC and CTAGAG sequence elements , which will add up if the two motifs are separated by a distance close to the helical repeat length . |
| 11 | After reading some of the comments from people who saw the game or who listened on the radio , the above seems to be about as true reporting as you 'd expect from the NOTW . |
| 12 | For all that , the way in which he was publicly rebuked by Peter May , the chairman of Selectors , after returning home , and appointed only for the first Test against India , annoyed many people by its insensitivity and seemed to be about as productive as the shooting of Admiral Byng on his quarterdeck . |
| 13 | Unfortunately for Brooks , the potential market share for the Beast is likely to be about as high as that enjoyed by the Land Rover , which is really a function of its specialist design rather than any deficiency in the shoe . |
| 14 | Pete did n't know whether to duck or run , and the choice was fairly academic anyway , as for the moment his body seemed to be about as responsive as a sack of rocks . |
| 15 | He has embarked on a drawing/painting course which seems to be about as full and hectic as yours , but then both your chosen activities are a mystery to me . |
| 16 | Our Friday debates tend to be of rather higher quality than some of our midweek debates and all hon. Members who have spoken so far — and , I am sure , those who will follow me — have spoken to a high standard and have contributed to a serious debate on this important issue . |
| 17 | As a staff development activity it is designed to be of both immediate and long-term use in the classroom and school setting , and thus meets an important stipulation for effective in-service work . |
| 18 | Note that there is no implication that this ‘ quality check ’ found the modules to be of particularly high quality : merely that they were fit for the purpose intended for the baseline . |
| 19 | What were once thought of as " mere " political " forms " are now recognized to be of far greater potential and actual importance than an exclusive concentration on economic and social power might suggest . |
| 20 | This greater reliance on context means that the branch of linguistics termed ‘ pragmatics ’ ( e.g. Levinson 1983 ; Sperber and Wilson 1986 ) is likely to be of far greater significance than semantics of syntax in those material culture studies which investigate the object 's communicative abilities . |
| 21 | So unlike for the basic rate taxpayer , the impact of the Budget tax credit changes is much less significant for the higher rate taxpayer — particularly as the capital gains tax exemption the PEP provides is likely to be of far more value to wealthier investors . |
| 22 | Until the 1980s the killing of 2000 or so pilot whales each year in the Faroe Islands was considered to be of far less significance than the slaughter of tens of thousands of the much rarer great whale species . |
| 23 | Even the so-called ‘ sexual function ’ of the family — that is the function of regulating and channelling sexual activity — would appear to be of more limited significance today , although supporters and opponents of the ‘ permissive society ’ alike may both be guilty of confusing talk about and representations of sexual activity with actual practice . |
| 24 | Other crustal fragments , while appearing to be of more local origin , have , none the less , experienced significant horizontal displacement and rotation with respect to the plate of which they form a part . |
| 25 | So far , therefore , the findings have tended to be of more obvious value to the accountant than to those responsible for planning advertising . |
| 26 | The weekly covers things he more or less knows about and it seems more often to be of more direct concern to him and his family than an event that happened elsewhere . |
| 27 | Whether this provided any dating evidence I can not remember , but at the bottom of this deposit was an earlier pavement which proved to be of much greater interest , as it was a most unusual pattern of a scroll of trumpet-shaped leaves . |
| 28 | Other squat , duck-like birds are comparable to those at Barton Farm ; indeed , whereas the animals in these mosaics appear to be of quite different styles , it seems that the draughtsman responsible for the birds at Barton Farm was also responsible for those at Withington . |
| 29 | 5.4.7 Both schools illustrate the fact that developments in Stage 3 of the project can be seen to be of potentially greater significance than the immediate effects of securing and expending a Major grant . |
| 30 | Amongst traditional scholars , H. C. Wyld was particularly inclined to place a high value ( for reconstructing EModE pronunciation ) on ‘ occasional spellings ’ and rhymes/puns in written English , and to consider the evidence of contemporary commentaries ( the work of the ‘ orthoepists ’ ) to be of less immediate value , as these can often be difficult to evaluate . |