Example sentences of "[unc] [noun] [noun] [coord] [verb] " in BNC.
Next pageNo | Sentence |
---|---|
1 | This latter finding provides further evidence of the in vivo platelet activation and release reaction . |
2 | D. M. C. Bandara Power and Energy *Weerasinghe Mallimarachchi Food and Co-operatives *Rupasena Karunatilleke Ports and Shipping * R . |
3 | Serves 4. 4 lamb steaks , about 675g ( 1½ lb ) 4 garlic cloves , skinned and crushed 3 tbs extra virgin olive oil 450ml ( ¾ pint ) dry cider 225g ( 8oz ) trimmed leek 100g ( 4oz ) potato 25g ( 1oz ) spinach and parsley , mixed 4 tbs single cream or low-fat fromage frais Crush garlic and rub well over the lamb . |
4 | For DNase I and hydroxy radical digestion experiments the 55-mer 5'CGGAGGGGCCCTAGAGGGCCCTAGAGGGCCCCCCAAAAACCCCCAAAAACCCCCC3' ( Watson strand ) and its complementary strand were synthesized using an Applied Biosystems 381A oligonucleotide synthesizer and purified by 8% denaturing polyacrylamide gel electrophoresis . |
5 | FRENCH socialist millionaire Bernard Tapie has sold his 1.6 p.c. stake in Societe Television Franaise and has resigned as managing director of Bernard Tapie Communication . |
6 | The 15″ monochrome NCD15r has a resolution of 1,024 x 800 , comes with from 4Mb to 20Mb RAM , NCD 's X11 server software and costs £1,470 . |
7 | Lacking specific benchmark data , The Microprocessor Report extrapolates from DEC 's 200MHz SPECmark claim and figures a 150MHz Alpha chip should perform at over 110 SPECmarks . |
8 | Just use the S3 engine mounts and clutch plate and modified 110 exhaust system . |
9 | as part of the overall er assessment reporting and recording |
10 | But I mean I think we , I think I , I will need on Monday morning to talk to er Morecambe Bay and see if I can bring forward these promotions because |
11 | Th er er s drop-leaf tables are marvellous cos you get to the end of the side of your packing you see and you might have a gap just about the right size so in you put the wrapper you put the table in and you might have a little gap like left so you get the this the you get the er ironing board and put that in there . |
12 | Okay press the er escape key and go back to the regression results , erm so return to the post regression menu and then display regression results , regressult results again . |
13 | The results for one set of three questions on a recipe was in the GT4 reference test and has already been discussed in the previous chapter . |
14 | A question asking pupils to interpret a 2-D depiction of a 3-D situation was included in the GT4 reference test and reported earlier ( p.40 ) . |
15 | I found by adapting that approach erm I 've been able to help clients in such areas as er tax saving or making their money work that little bit harder for them . |
16 | There has been a kind of stalemate in the class struggle which has placed governments in the position of tackling deep-rooted problems with technocratic instruments of strictly limited effectiveness : they have held the line on the balance of payments by means of periodic deflation , which has not really solved anything ; they have periodically checked inflation and attempted to rebuild industrial profitability by means of ad hoc incomes policy but have been unable either to maintain popular support for such policies or to push forward to a comprehensive planning of prices and incomes , investment and consumption . |
17 | er if it 's people give you things like reference lists and reading lists , I mean sometimes that 's the most confusing thing to be given because you do n't know , I used to think you were supposed to read everything on them er and I actually tried doing that once or twice and I could n't find stuff in Aston library so I ran up the er town library and went to Birmingham University library and then I got back the next week and I realized that I was about the only person who 'd actually done that and other people had n't |
18 | This study shows the transfection of HPV DNA from colonic cancers into NIH3T3 mouse cells and suggests that HPV type 16 might be associated with the malignant transformation of colonic cells . |
19 | Er what made me smile when they found out that the salt were going through these er motorway bridges and attacking the steel work in the concrete with all sort of powers that they would of known that would n't ya ? |
20 | Then pick up the pace to within 20 to 30 seconds per mile of your 10K race pace and hold that for seven minutes . |
21 | Kafiluddin Ahmed Finance Fakhruddin Ahmed Foreign Affairs M. A. Majeed Health and Family Welfare Zillur Rahman Siddiqi Education Mohammad Abdul Khaliq Law and Justice A. B. M. G. Kibria Communications Maj. ( retd ) Mohammad Rafiqul Islam Civil Aviation , Tourism and Shipping *Rehman Sobhan Planning , Irrigation , Water Resources and Flood Control *Wahiduddin Ahmed Energy and Works *Alamgir M. A. Kibir Social Welfare , Women 's Affairs and Sports * A . |
22 | The inverted repeats of IS1151 are homologous to the corresponding sequences of the IS231 and IS4 insertion elements but diverge from those of IS186 and of IS421 . |
23 | learning how to clean pot pa , er bed pans and make beds and things like that |
24 | It was because the people were used to that kind of society with a secret police and er government inspectors and sending people out to Siberia and putting |
25 | This was a bar that er went under the bomb like that when they fastened them up , and then when they dropped the bombs this bar was in a clip , like where me finger is , i in a clip so when they released them it dropped out of this clip the bar went as well of course , down that went down went the bomb drop bars with it used to be make them day and night and things like that and er of course there was er Bloxwich Lock and Stamping we used to do odd stamping , odd forgings and things li and er that was other part of the war work . |
26 | when I got there , several times he used to scruffle into the er packing room and come out with those two , three of those well a couple of those large sheets of brown paper that they pack , yeah , pack the few boxes in |
27 | I housed both the processor and amp in an SKB 2U rack case and hardwired a double mains board in the back . |
28 | The black box represents the NcoI-EcoRI oligonucleotide adaptor inserted to maintain the 140k reading frame and to facilitate the insertion of the EcoRI-BstEII gene 62 fragment from plasmid pV17 into the vector p585T7a . |
29 | Erm the actual form D three five erm bar chart was filled in with er milestone dates and nominates people . |
30 | However , group tour visitors do not order à la carte items and consume fewer drinks with or after their meals . |