Example sentences of "[pron] [adj] at the [adj] " in BNC.
Next page| No | Sentence |
|---|---|
| 1 | Recombinants ‘ oligo I ’ and ‘ oligo III ’ were produced by cloning the sequence CTGGGGAGGCGACCCCTCCCCCCTTGTCCCGACT ( nts -527 to -494 ) and its complementary or the oligonucleotide TCGCCCAGCTCAGGGCCGCGTGTGTTAGTT ( nts -479 to -450 ) and its complementary at the HindIII site of plasmid pBLcat2 ( 16 ) . |
| 2 | An excursion to the top of the high alpine road of Gross Glockner will leave you breathless at the fantastic views stretching as far as the eye can see in every direction . |
| 3 | Does this mean therefore that RMI has to be a massive concentrated effort to bring everything on-stream at the same time ? |
| 4 | A good horse trainer teaches a horse good habits so that it does what he wants it to do automatically , without it learning any undesirable behaviour or bad habits in the process ; but a poor trainer often finds that his horses learn something unwanted at the same time . |
| 5 | You ca n't and keep them open at the same time . |
| 6 | Then on the second day , Nicklaus puts it stone-dead at the 5th and so he 's taken just three shots for the 5th ! |
| 7 | However , Ada had made it clear at the first round of talks that the commission had no power to negotiate changes , which had to be approved by referendum . |
| 8 | All those red and green LEDs from the two graphic equalisers and their level indicators should knock 'em dead at the next British Legion Blues Night ! |
| 9 | THE Coleraine club and local competitors again did us proud at the European Championship meeting at Kirkistown . |
| 10 | And you 're doing your utmost at the other end straining , trying even harder and harder , the harder you try often the worse it gets . |