Example sentences of "[prep] be [prep] [adv] [adj] " in BNC.
Next pageNo | Sentence |
---|---|
1 | The first type tend to be over more mundane matters , with the third being the more serious . |
2 | An important part of the discussion deals with the difficulty of deciding whether variation can be said to be between semantically equivalent forms which carry social meaning , or to encode an aspectual distinction ; this latter issue is treated in the context of a ( non-quantitative ) analysis of the semantic distinctions underlying tense and aspect marking ( see further 7.6 and 7.7 ) . |
3 | " It 's humiliating to be worth more dead than alive . " |
4 | ‘ MOST OF your articles seem to be about very physical hobbies , would you be interested in hearing about one that is n't ? ’ asked Rosemary Gardner who works in Harwell 's Market Intelligence Service , part of Business Strategy Unit . |
5 | Physical trapping is likely to be about as effective for neon , argon and krypton . |
6 | He realised with a shock that he was nervous — as nervous as a randy adolescent on a hot date — and likely to be about as subtle ! |
7 | The effect of the GC step in the context of GGGCCC motif seems to be about as large as that of AA/TT , i.e. it is apparently enough to cancel the macroscopic curvature of helically phased A-tracts.The origin of the macroscopic curvature for the ( AGGGCCCTAGAGGGGCCCTAG ) n DNA can be explained by an overall roll angle difference between the GGGCCC and CTAGAG sequence elements , which will add up if the two motifs are separated by a distance close to the helical repeat length . |
8 | After reading some of the comments from people who saw the game or who listened on the radio , the above seems to be about as true reporting as you 'd expect from the NOTW . |
9 | For all that , the way in which he was publicly rebuked by Peter May , the chairman of Selectors , after returning home , and appointed only for the first Test against India , annoyed many people by its insensitivity and seemed to be about as productive as the shooting of Admiral Byng on his quarterdeck . |
10 | Unfortunately for Brooks , the potential market share for the Beast is likely to be about as high as that enjoyed by the Land Rover , which is really a function of its specialist design rather than any deficiency in the shoe . |
11 | Pete did n't know whether to duck or run , and the choice was fairly academic anyway , as for the moment his body seemed to be about as responsive as a sack of rocks . |
12 | He has embarked on a drawing/painting course which seems to be about as full and hectic as yours , but then both your chosen activities are a mystery to me . |
13 | As a staff development activity it is designed to be of both immediate and long-term use in the classroom and school setting , and thus meets an important stipulation for effective in-service work . |
14 | Note that there is no implication that this ‘ quality check ’ found the modules to be of particularly high quality : merely that they were fit for the purpose intended for the baseline . |
15 | Even the so-called ‘ sexual function ’ of the family — that is the function of regulating and channelling sexual activity — would appear to be of more limited significance today , although supporters and opponents of the ‘ permissive society ’ alike may both be guilty of confusing talk about and representations of sexual activity with actual practice . |
16 | Other crustal fragments , while appearing to be of more local origin , have , none the less , experienced significant horizontal displacement and rotation with respect to the plate of which they form a part . |
17 | So far , therefore , the findings have tended to be of more obvious value to the accountant than to those responsible for planning advertising . |
18 | The weekly covers things he more or less knows about and it seems more often to be of more direct concern to him and his family than an event that happened elsewhere . |
19 | Other squat , duck-like birds are comparable to those at Barton Farm ; indeed , whereas the animals in these mosaics appear to be of quite different styles , it seems that the draughtsman responsible for the birds at Barton Farm was also responsible for those at Withington . |
20 | Amongst traditional scholars , H. C. Wyld was particularly inclined to place a high value ( for reconstructing EModE pronunciation ) on ‘ occasional spellings ’ and rhymes/puns in written English , and to consider the evidence of contemporary commentaries ( the work of the ‘ orthoepists ’ ) to be of less immediate value , as these can often be difficult to evaluate . |
21 | On close inspection , several of the demonstrations of a dissociation between latent inhibition and habituation turn out to be of less theoretical significance than they first seemed . |
22 | For instance , hoods that roll away into the collar tend to be of fairly simple design but , if you are spending hours in the rain , you may need a more protective version . |
23 | One argument ( see Caves and Christensen , 1980 ) is that in competitive industries , all concerns have to be of roughly equal efficiency , whereas in the absence of competition , publicly owned concerns will be inferior . |
24 | the level below which certain collocates are deemed to be of too low frequency to be statistically stable . |
25 | Our investigations of characteristics of user establishments were made only for the private sector , since we assumed non-market forces to be of too great importance in the public sector to permit most of the relevant propositions to be tested . |
26 | Our data support the results of other studies which have found the erythrocyte sedimentation rate to be of very limited value . |
27 | I have always found the Rottweilers in Norway to be of very stable disposition , and this is probably because the Rottweilers live as family pets , with a stable home life . |
28 | All the chairmen made an effort to reply to inaccurate or unverifiable press criticism , and to stress their Boards ' positive work in maintaining supplies in difficult conditions of great austerity , but experience proved truth to be of only limited effectiveness against prejudice . |
29 | ‘ No , ’ he answered softly , ‘ I 'm saying that I now consider the IRB to be of only secondary importance . ’ |
30 | Although personally we believe this to be of only secondary importance , its probable role in motivating innovative acts can not be ignored . |