Example sentences of "[conj] [vb -s] with the " in BNC.
Next pageNo | Sentence |
---|---|
1 | He , too , has the courage to speak out , and so has Ted Heath , whether what they say is right or wrong or agrees with the party line . |
2 | Please do not hesitate to contact me if you have any queries or concerns with the tape or Handbook . |
3 | In part two : Tactical weapons : The Tory seat that sinks or swims with the floating voter . |
4 | It also believes that planning can ensure that new buildings are designed in a way which it likes , and has an ability to prevent anything , however small , happening near its own house which reduces its value or interferes with the way in which it has been in the habit of using it . |
5 | It 's the way his past interfaces or connects with the present . |
6 | Except that trusts of land must be created by writing , a trust may be created by any sufficient expression of intention to create it , whether the legal ownership is transferred to another to hold as trustee or remains with the creator of the trust , who in that case will himself be the trustee . |
7 | There are particular difficulties on the question of whether a covenant is purely personal or runs with the land where the obligation in question , whether on the part of the lessor , lessee , or third party guarantor , involves the payment of money other than rent . |
8 | The fact that you realise that it is out of his area of interest but may be useful to him personally should be made clear in the covering note that goes with the sample . |
9 | well that goes with the numbers . |
10 | ‘ The one that goes with the Slow Children sign at the other end of the village . ’ |
11 | Here the stimulus is a noun from a variety of classes and you have to choose the affix that goes with the numeral . |
12 | But I stay out there singing some made-up song that goes with the waves crunching on the shingle , so she tosses stones in the water to plop near me in the darkness and I shout like an idiot and run back to the shore . |
13 | The static , closed image of the literary text that goes with the concept of structure is replaced by a dynamic , open one which is expressed in concepts like play and practice . |
14 | No you must use the video remote control that goes with the video . |
15 | The behaviour of atoms in this sensibility is governed by the same principles that apply to human systems , or any energetic system throughout nature or the universe that interacts with the medium in which it exists ( its environment ) and exchanges energy . |
16 | The fantasy city that interacts with the real one . ’ |
17 | The side chains of CyP residues Trp121 , Phe60 , Ile57 , Leu122 , Phe113 , His126 , Ala101 , Ala103 and Thr73 form a hydrophobic pocket that interacts with the hydrophobic surface of CsA residues 9–11 and 1–3 ( Fig. 2 ) . |
18 | We have recently cloned cDNA encoding the large subunit of TFIIF that interacts with the small subunit in vivo and shown that bacterially expressed proteins of both could replace the transcription initiation activity of native TFIIF ( 20 ) . |
19 | Recently physical interaction of the carboxyl-terminal domain ( CTD ) of the largest subunit of RNA polymerase II with TATA-binding protein has been shown and it was proposed that the CTD is one of the components of the RNA polymerase II that interacts with the DAB complex during recruitment of the enzyme ( 47,48 ) . |
20 | Is there then a single component contained within the EHS substratum that interacts with the hepatocyte to affect specific gene expression that is missing from plastic or simple substrata ? |
21 | This suggests that , instead of a once-and-for-all decision at the end of the analysis , there may be a process of evaluation that develops with the project , and that decisions and analyses are not undertaken without consideration of prior experience . |
22 | Never fear , because QED ( 0784 246236 ) have introduced a ‘ Discsaver ’ black box that juggles with the output signal of the deck so it can safely be fed through the ‘ Aux ’ or ‘ Video ’ input of such thoughtless systems . |
23 | As previously described , the northern blot results were normalised by rehybridising the filters with a P 3 2 -labelled oligonucleotide ( 5'AACGATCAGAGTAGTGGTATTTCACC 3' ) that corresponds with the 28s ribosomal ribonucleic acid . |
24 | The kind of record that rings with the influence of many ( Hendrix , Beach Boys , Beefheart for starters ) , but still stays true to its own school . |
25 | The kind of nose that flirts with the idea of being stroked and kissed and nibbled . |
26 | as if explaining away the downright lies and beautiful evasions of his Westerns , this is the one ( echoing Fort Apache , 1948 ) that concludes with the idea that if the legend is better than the truth then you should ‘ print the legend ’ . |
27 | His species propagation theorizing itself was accordingly constructed , from the very opening of Notebook B , as an argument that starts with the sexual generation of one individual organism from another and ends with the propagation of one species from another . |
28 | Goeres and Sedlmayr propose the sixfold combination of napthalenic C 10 units ; Wakabayashi and Achiba propose a mechanism that starts with the combination of napthalenic C 10 unit with a ring C 18 . |
29 | If the pressed flower picture is to hang in a kitchen , then perhaps a pine frame would be suitable , or a frame with a coloured line that blends with the soft furnishings . |
30 | It was soon realized that more than one reservoir was required in order to avoid the slowing down of timekeeping that occurs with the falling pressure-head in a single vessel . |