Example sentences of "previous [noun] we [verb] that [art] " in BNC.
Next pageNo | Sentence |
---|---|
1 | In a previous paper we estimated that the sex and age standardised population relative risk for ulcerative colitis and Crohn 's disease was about 10 among first degree relatives of probands with ulcerative colitis and Crohn 's disease . |
2 | In a previous paper we reported that the repeating sequence 5'AGGGCCCTAGAGGGGCCCTAG3' displays an anomalous gel mobility , characteristic for curved DNA , even in the absence of AnTm tracts ( 4 ) . |
3 | In the previous section we argued that the cereal-packet image of family life in modern Britain was seriously misleading in that , at any one time , relatively few families conform to the image and many households never do . |
4 | In the previous section we mentioned that the programmer using fixed-point binary format could consider the binary point to be at an appropriate position in the word for each item of data . |
5 | In the previous section we suggested that a government could use taxes and welfare benefits to redistribute income-earning potential and thereby enforce its value judgements about equity while leaving the market economy to take care of allocative efficiency . |