Example sentences of "[n mass] [num] [prep] " in BNC.
Next pageNo | Sentence |
---|---|
1 | The hybridization reactions were performed with 250 ng HIV-1 pHIVCG8.6 RNA ( pos. 8600–9227 with a 22 nt poly(A) tail ) in buffer containing 25 mM Tris-Cl ( pH 7.0 ) , 25 mM NaCl , 7 mM dithiothreitol , 100 mM MgCl 2 , 10 mM ZnCl 2 and 8 units of RNAsin in the absence or presence of NCp7 during 15 min at 37°C . |
2 | In 1845 he published in vol. vi of the Journal of the Royal Agricultural Society of England the results of a successful experiment in cultivating swedes to determine what would happen when the essential constituents of a plant were supplied to ‘ barren ’ land . |
3 | Recombinants ‘ oligo I ’ and ‘ oligo III ’ were produced by cloning the sequence CTGGGGAGGCGACCCCTCCCCCCTTGTCCCGACT ( nts -527 to -494 ) and its complementary or the oligonucleotide TCGCCCAGCTCAGGGCCGCGTGTGTTAGTT ( nts -479 to -450 ) and its complementary at the HindIII site of plasmid pBLcat2 ( 16 ) . |
4 | 5 of vol. 2 of The Mysteries of Udolpho ( 1794 ) . |
5 | A solar collector area of around 4m 2 to 5m 2 is usually considered the optimum . |
6 | The atmosphere is massive , 103 × 10 4 kg/m 2 , which dwarfs the 1.04 × 10 4 kg/m 2 of the Earth 's atmosphere . |
7 | Taking account of all the knock-on of effects on productivity and business , a cut finger might cost a company £782 , and the cost could escalate to £15 306 for a broken arm . |
8 | The pear-shaped ‘ image of the Holy Mother of God ’ , which was held by women in labour , is expected to be sold for around £1 500 on November 24 . |
9 | Mortgage facilities were generous and , although prices were low in national terms in 1982 — between £10 000 for single studio flats and £16 500 for maisonettes — they were not low for Tyneside . |
10 | After years of acrimonious dispute , the president of Brazil , Fernando Collor de Mello , has announced the demarcation of 94,000km 2 of northern Brazil as the territory of the Yanomami , the largest Indian group in the Amazon rainforest . |
11 | Readers wishing to lend support to President Collor 's plan to demarcate as soon as possible 94,000km 2 of Yanomami territory , guaranteeing them rights to their land , should write to President Fernando Collor de Mello , Palacio do Planalto , Praca dos Três Poderes , 70.150 Brasilia , DF Brazil . |
12 | Myers has estimated that by the end of the century , at present rates , there will be only two relict blocks : western Brazilian Amazonia and Zaire , with smaller ones in New Guinea and the Guyana Shield of South America , but that these are unlikely to last beyond 2050 because of cultivation as , for example , the population in Rondonia in south Brazilian Amazonia increased from 1100 in 1975 to well over a million by 1986 , with an increase in cultivation from 1250km 2 to 10000 in 1982 and 17000 in 1986 . |
13 | 1946 , increased the Exchequer subsidy to £16 10s per house for 60 years ; a rate contribution of £5 10s was also required . |
14 | However , railways only made up 3 metres of every kilometre squared of territory as opposed to 200m/1km 2 in Britain . |
15 | Eden estimated that the Cornish tin and copper miners earned around 10s ( 50p ) a week in 1797 , while a select committee of 1799 gave a monthly range of £1 10s to £2 2s ( £1.50p — £2.10 ) . |
16 | Nevertheless , between 1950 and 1975 the amount of pasture doubled and between 1966 and 1978 , perhaps as much as 80000km 2 of Brazil 's forests disappeared in the formation of ranches . |
17 | Reversing this statement , the present value of £1 10 to be received in one year 's time is £100 . |
18 | Although Groupe Bollore was identified as the cartel 's ringleader , 13 other European shipping firms were fined Ecu 300,000 for their lesser role in what was described as a ‘ particularly harmful cartel ’ that had shut out rival shipping lines and led to excessive prices . |
19 | Subscription income has risen from £.743 m to £.779 m , an increase of 4.8% . |
20 | Shearer beat the offside trap and squared the ball for Mitchell to tap in. 3-1 to Town . |
21 | Companies must refinance £20 billion of warrants and bonds this year convertible into equities at prices way above today 's , nearly £50 billion next year and £24 billion in 1994 . |
22 | Never again , because in sheer economic terms it is lunacy to spend upwards of £80 million to knock out a war machine that actually only provided some £20 billion of contracts for western industry . |
23 | Instead , anything from £20 billion to £30 billion a year has been spent on benefit for the growing army of unemployed , surely the least satisfactory possible way of spending money which should have been invested . |
24 | Companies are spending record sums of some £20 billion on training per year , and the CBI survey shows an increase in the year ahead , with more than 80 per cent . |
25 | The repair bill for public-sector accommodation is estimated to be at least £20 billion in 1986 prices ( Association of Metropolitan Authorities , 1986 ) , a year in which total capital spending amounted to about £5.5 billion . |
26 | In the UK at the present time ( 1988 ) the balance of trade deficit has increased from £10.2 billion in 1987 to almost £20 billion in 1988 . |
27 | The Chancellor has raised an extra £6.5 billion in revenue in 1994–95 , when the VAT and certain other changes take effect , and £10.5 billion in 1995–96 . |
28 | In a controversial tax package , spread over three years , he plans to raise £10.5 billion by increasing national insurance contributions and putting VAT on domestic fuel bills . |
29 | We 've got a committment to spen £23 billion on new roads . |
30 | Central government 's total cash receipts were £23 billion in January and £170 billion for the year to date , compared with £23.3 billion in January 1992 , and £170 billion for the last financial year at this point . |